Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircRNA-0004904 | |||
Gene | POLE2 | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Pre- Eclampsia (PE) | ICD-10 | Pre-eclampsia (O14) |
DBLink | Link to database | PMID | 29758559 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 5 women in screening phase with PE in gestation phase and 30 women with PE for validation phase |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GATAAAGCAGAGATGTTTCGTGAGC ReverseTACACAAAGCGTGGAATATCAAATG | Statistics | Fold Change : Upregulated,47.33 pvalue : p=0.000434388 |
Citation | |||
Jiang, M, Lash, GE, Zhao, X, Long, Y, Guo, C, Yang, H (2018). CircRNA-0004904, CircRNA-0001855, and PAPP-A: Potential Novel Biomarkers for the Prediction of Preeclampsia. Cell. Physiol. Biochem., 46, 6:2576-2586. |