circad | circRNAs associated with diseases

CircRNA-0004904
Gene	POLE2	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Pre- Eclampsia (PE)	ICD-10	Pre-eclampsia (O14)
DBLink	Link to database	PMID	29758559
Experimental Method
Sample Type	Blood samples	Comparison	5 women in screening phase with PE in gestation phase and 30 women with PE for validation phase
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GATAAAGCAGAGATGTTTCGTGAGC Reverse TACACAAAGCGTGGAATATCAAATG	Statistics	Fold Change : Upregulated,47.33 pvalue : p=0.000434388
Citation
Jiang, M, Lash, GE, Zhao, X, Long, Y, Guo, C, Yang, H (2018). CircRNA-0004904, CircRNA-0001855, and PAPP-A: Potential Novel Biomarkers for the Prediction of Preeclampsia. Cell. Physiol. Biochem., 46, 6:2576-2586.